Scholarly Search Engine

My skool app

Name

Dynamic Stability of the Peace River Transmission System

W. Skoolund  "Dynamic Stability of the Peace River Transmission System",  IEEE Transactions on Power Apparatus and Systems ,  vol. PAS-85,  pp.586 -600 1966...Power Appar. Svst., pp. 586-600, 1966.Ellis H M,Hardy J E,Blythe A L,et...

Stars: 73 Updated: September 4th,2018

Identification of a human cDNA encoding a protein that is structurally and functionally related to the yeast adenylyl cyclase-associ...

GGCGOTGACTTTAATGAATTCCCAGTTCCTGAGCAGTTCJA0ACCCTATGGACGGGCAGAAGTTGQTCACCACAGTGACAGAAATTCTGGATA&GC 445 GlyGlyApPh.AunGluP...111sl1 s YLSKOOLOOHVTSKBTOLHIW-NP-HNGWARARPVPNQXKMHNKOLVSZIVRHN 111111 1:1 11 :1: :1 1 11:1 11111 s YL8SLD...Ade...

Stars: 176 Updated: September 4th,2018

Web Frameworks Smackdown at JavaOne 2005

One thing I hope the audience noticed is the fact that four of the five panel members agreed on 'web mvc' being old skool technology. It is not about being cool or something, ...Here's my suggestion: I whipped up the world's simplest ...

Stars: 52 Updated: September 4th,2018

A Multiplicative Model for Learning Distributed Text-Based Attribute Representations

the cure of the bad the truth of the good a penny for the fourth the globe of those modern all man upon the same [TO, VB, VBD, JJS, NNS] my greatest accomplishment is......skool project book yearbook provide acquire generate rapture g...

Stars: 109 Updated: September 4th,2018

A simple model based on known plant defence reactions is sufficient to explain most aspects of nodulation

The ~mciclll nod-on will thus be actlllg functionally as a parti~l nod-off Thi~ appcar~ orFilo;.. -I. r....References Arora N, SkOOl:: F, Alien ON. 1959. Kinelin-induced pseudollod- ules on tob:\eco root~. American }ol...tm Society oj...

Stars: 137 Updated: September 4th,2018

Die Transvaalse skoolkalender / Jan Harm Pieter Ignatius Michiel Ackermann

  mirage Die Transvaalse skoolkalender / Jan Harm Pieter Ignatius Michiel Ackermann Boloka/Manakin Repository Login ... Name: Ackermann_JHP_App ... Size: 621.8Kb Format: PDF Description: Appendix & biblio ... View/Open ... This Co...

Stars: 96 Updated: September 4th,2018

Use of antipsychotic drugs among Dutch youths between 1997 and 2005.

Kalverdijk LJ, Tobi H, van den Berg PB, Buiskool J, Wagenaar L, Minderaa RB, de Jong-van den Berg LT (2008) Use of antipsychotic drugs among Dutch youths between 1997 and 2005. Psychiatr Serv 59(5):554–560. : 10.​1176/​appi.​ps.​...

Stars: 88 Updated: September 4th,2018

Funksies van grondgebruik

Naby Greenacres vind ons reeds die hoofkantore van banke en versekeringsmaatskappye. Wat vroeër deel van die woon... 2. Die funksie van die grond in my omgewing Bestudeer die tabel en bykomende inligting en volg die instruksies...sk...

Stars: 33 Updated: September 4th,2018

matched results. Showing page 1 of 4.